ID: 973947834_973947839

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 973947834 973947839
Species Human (GRCh38) Human (GRCh38)
Location 4:55977990-55978012 4:55978024-55978046
Sequence CCCTTACAGCCTTCAGCATTGCG ATGTGCATGTGTGTGTTTAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 175} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!