ID: 973947835_973947841

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 973947835 973947841
Species Human (GRCh38) Human (GRCh38)
Location 4:55977991-55978013 4:55978043-55978065
Sequence CCTTACAGCCTTCAGCATTGCGC GGGGACAGTGGAGTAGTGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 85} {0: 1, 1: 0, 2: 4, 3: 22, 4: 334}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!