ID: 973950425_973950430

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 973950425 973950430
Species Human (GRCh38) Human (GRCh38)
Location 4:56007449-56007471 4:56007500-56007522
Sequence CCTACAGCATGTTGTTACTGAAC AGTAATAGAGAAGAGTTTCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 25, 4: 171} {0: 1, 1: 1, 2: 3, 3: 49, 4: 297}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!