ID: 973950425_973950431

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 973950425 973950431
Species Human (GRCh38) Human (GRCh38)
Location 4:56007449-56007471 4:56007501-56007523
Sequence CCTACAGCATGTTGTTACTGAAC GTAATAGAGAAGAGTTTCCAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 25, 4: 171} {0: 1, 1: 1, 2: 3, 3: 55, 4: 268}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!