ID: 973954372_973954385

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 973954372 973954385
Species Human (GRCh38) Human (GRCh38)
Location 4:56048914-56048936 4:56048950-56048972
Sequence CCTGGTTTCTGGGCACCCCTGGG TGGTGTGCGCCACTCCCGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 4, 4: 38}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!