ID: 973954386_973954394

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 973954386 973954394
Species Human (GRCh38) Human (GRCh38)
Location 4:56048959-56048981 4:56048992-56049014
Sequence CCACTCCCGGAGGGCGCGAGAAG CCTCACGCTCAGCTGTCCCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 15, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!