ID: 973954391_973954405

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 973954391 973954405
Species Human (GRCh38) Human (GRCh38)
Location 4:56048986-56049008 4:56049019-56049041
Sequence CCGGCGCCTCACGCTCAGCTGTC GCCGGGCGGGGCGGCGGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 126} {0: 1, 1: 6, 2: 28, 3: 310, 4: 1805}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!