ID: 973961345_973961356

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 973961345 973961356
Species Human (GRCh38) Human (GRCh38)
Location 4:56112828-56112850 4:56112870-56112892
Sequence CCTTTATTTCTATGCTTGGAGGG GTCCTGCTGCATCACATTATTGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 20, 3: 61, 4: 194} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!