ID: 973981856_973981870

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 973981856 973981870
Species Human (GRCh38) Human (GRCh38)
Location 4:56314441-56314463 4:56314489-56314511
Sequence CCTGGAGGCGGAGGAGGAGCGAA GGAGGAGAGGCGGCGGCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 556} {0: 1, 1: 0, 2: 18, 3: 140, 4: 1112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!