ID: 973981862_973981875

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 973981862 973981875
Species Human (GRCh38) Human (GRCh38)
Location 4:56314476-56314498 4:56314512-56314534
Sequence CCCAGGCCCAAGCGGAGGAGAGG AGGACGCCAGGCTGGAGGAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 269} {0: 1, 1: 0, 2: 6, 3: 37, 4: 760}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!