ID: 973983363_973983368

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 973983363 973983368
Species Human (GRCh38) Human (GRCh38)
Location 4:56325674-56325696 4:56325715-56325737
Sequence CCTTATTACCAATCACTTGAAGG GCTCCCTACCAGTGATTAATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 89} {0: 1, 1: 0, 2: 0, 3: 8, 4: 59}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!