ID: 974009568_974009575

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 974009568 974009575
Species Human (GRCh38) Human (GRCh38)
Location 4:56594549-56594571 4:56594590-56594612
Sequence CCTACTTAAACCAGAAAGGAGAG CTCATTCTGAAATCAACACATGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 4, 3: 20, 4: 193} {0: 1, 1: 0, 2: 2, 3: 14, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!