ID: 974078743_974078745

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 974078743 974078745
Species Human (GRCh38) Human (GRCh38)
Location 4:57191809-57191831 4:57191838-57191860
Sequence CCACAGCCTTTAGTCTCTACATG TTGTCAAAATGCAACATCAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 27, 4: 267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!