ID: 974178822_974178828

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 974178822 974178828
Species Human (GRCh38) Human (GRCh38)
Location 4:58359405-58359427 4:58359452-58359474
Sequence CCAATAATTTACCCAATTATAAA ATGTATTAGCAGAATGAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 57, 4: 446} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!