ID: 974289565_974289572

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 974289565 974289572
Species Human (GRCh38) Human (GRCh38)
Location 4:59912712-59912734 4:59912757-59912779
Sequence CCTGCCATCTTCTACAGTTAACT CTTGGCTTGTCACTGGGCTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 11, 2: 186, 3: 195, 4: 309}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!