ID: 974289608_974289614

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 974289608 974289614
Species Human (GRCh38) Human (GRCh38)
Location 4:59913027-59913049 4:59913073-59913095
Sequence CCTGCACTGATGACCTCATGGGG AGGAAGAGAAGACTAGAACCTGG
Strand - +
Off-target summary {0: 16, 1: 63, 2: 97, 3: 178, 4: 321} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!