ID: 974297368_974297377

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 974297368 974297377
Species Human (GRCh38) Human (GRCh38)
Location 4:60019104-60019126 4:60019156-60019178
Sequence CCATATGAAGATAAAATGAAGGC TGGGACTCTATGGGAGAATCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 288} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!