ID: 974310395_974310402

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 974310395 974310402
Species Human (GRCh38) Human (GRCh38)
Location 4:60200889-60200911 4:60200910-60200932
Sequence CCAGGAAACCTCCCCCTCCACTT TTCATTCTGATTCAGTATATCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 368} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!