ID: 974385869_974385877

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 974385869 974385877
Species Human (GRCh38) Human (GRCh38)
Location 4:61201582-61201604 4:61201620-61201642
Sequence CCACCCTCCTGCTGCTTTCTCTG TATTTGCCGCGTGTGGTTGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 110, 4: 972} {0: 1, 1: 0, 2: 0, 3: 13, 4: 502}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!