ID: 974402619_974402630

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 974402619 974402630
Species Human (GRCh38) Human (GRCh38)
Location 4:61425712-61425734 4:61425746-61425768
Sequence CCCACAGAGGAGGGTTCCTTCCC CTATGAACAGTCATTCACGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 28, 4: 214} {0: 1, 1: 0, 2: 1, 3: 10, 4: 62}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!