ID: 974406898_974406902

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 974406898 974406902
Species Human (GRCh38) Human (GRCh38)
Location 4:61484376-61484398 4:61484397-61484419
Sequence CCTACCTAATACTTTCCTTAGTT TTAGGTCATCACTGCTTTATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 261} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!