ID: 974435655_974435656

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 974435655 974435656
Species Human (GRCh38) Human (GRCh38)
Location 4:61854256-61854278 4:61854285-61854307
Sequence CCATGTGTTGTTTTCTAGTAGGA AATAAAAACACCAGCCTCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 291} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!