ID: 974583402_974583405

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 974583402 974583405
Species Human (GRCh38) Human (GRCh38)
Location 4:63836800-63836822 4:63836829-63836851
Sequence CCTCCAGCCAGGAGGTGGCACTT ACATATAAGCTACAGTAGTATGG
Strand - +
Off-target summary {0: 106, 1: 268, 2: 395, 3: 415, 4: 556} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!