ID: 974600304_974600312

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 974600304 974600312
Species Human (GRCh38) Human (GRCh38)
Location 4:64071199-64071221 4:64071231-64071253
Sequence CCAATACAATGGGGGAAATGTCT GGCTAGGGGTCAGAATGATATGG
Strand - +
Off-target summary {0: 1, 1: 40, 2: 1343, 3: 1849, 4: 1720} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!