ID: 974641560_974641562

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 974641560 974641562
Species Human (GRCh38) Human (GRCh38)
Location 4:64639432-64639454 4:64639456-64639478
Sequence CCAGCATATGTACAGTTTTAAAT CTGTTTTCCATTAAGAAAAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 5, 3: 68, 4: 609}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!