ID: 974644614_974644619

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 974644614 974644619
Species Human (GRCh38) Human (GRCh38)
Location 4:64674755-64674777 4:64674794-64674816
Sequence CCCAGTAACAGGCCAAGAGCTGT AATTATCTGCAGGAAATGGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 20, 3: 232, 4: 414}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!