ID: 974710637_974710645

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 974710637 974710645
Species Human (GRCh38) Human (GRCh38)
Location 4:65589434-65589456 4:65589472-65589494
Sequence CCCACCTCCCTCTGTAACCACTG GCCACTGCTGTCAGAAAACAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 21, 4: 314} {0: 1, 1: 0, 2: 0, 3: 23, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!