ID: 974746911_974746917

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 974746911 974746917
Species Human (GRCh38) Human (GRCh38)
Location 4:66088887-66088909 4:66088935-66088957
Sequence CCACCAAAGCCCAGTAACAGACC AGTTATCTTCAGAAGATGGCAGG
Strand - +
Off-target summary {0: 17, 1: 155, 2: 153, 3: 106, 4: 231} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!