ID: 974746913_974746917

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 974746913 974746917
Species Human (GRCh38) Human (GRCh38)
Location 4:66088896-66088918 4:66088935-66088957
Sequence CCCAGTAACAGACCAAGAGCTGT AGTTATCTTCAGAAGATGGCAGG
Strand - +
Off-target summary {0: 13, 1: 193, 2: 204, 3: 150, 4: 243} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!