ID: 974746914_974746917

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 974746914 974746917
Species Human (GRCh38) Human (GRCh38)
Location 4:66088897-66088919 4:66088935-66088957
Sequence CCAGTAACAGACCAAGAGCTGTC AGTTATCTTCAGAAGATGGCAGG
Strand - +
Off-target summary {0: 13, 1: 174, 2: 196, 3: 141, 4: 196} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!