ID: 974785016_974785025

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 974785016 974785025
Species Human (GRCh38) Human (GRCh38)
Location 4:66609074-66609096 4:66609109-66609131
Sequence CCCTCTTCAGGTCTCTCAGCCAT TTTCTCTGATGGAGGTGGCTGGG
Strand - +
Off-target summary {0: 43, 1: 72, 2: 126, 3: 260, 4: 467} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!