ID: 974807091_974807101

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 974807091 974807101
Species Human (GRCh38) Human (GRCh38)
Location 4:66894583-66894605 4:66894613-66894635
Sequence CCAGGCCTCCCCTCCCAAAGAGG ATTAAAGAAAAATAGCTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 499} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!