ID: 974837047_974837052

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 974837047 974837052
Species Human (GRCh38) Human (GRCh38)
Location 4:67263811-67263833 4:67263849-67263871
Sequence CCCACCTAGAGGAAGAAATTCTA GAGTATAAAAGAGTCAGGAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 18, 4: 344}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!