ID: 974860680_974860684

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 974860680 974860684
Species Human (GRCh38) Human (GRCh38)
Location 4:67517523-67517545 4:67517545-67517567
Sequence CCTAACATAACGATTTCTAAATA ACTGCATTGTCGGCCGGGTGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 59, 4: 419}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!