ID: 974870205_974870207

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 974870205 974870207
Species Human (GRCh38) Human (GRCh38)
Location 4:67633302-67633324 4:67633329-67633351
Sequence CCAAGATCAGACCTTTTCTTAAT CACAATGCATACTTACCTTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 212} {0: 1, 1: 0, 2: 1, 3: 8, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!