ID: 974874395_974874400

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 974874395 974874400
Species Human (GRCh38) Human (GRCh38)
Location 4:67685598-67685620 4:67685626-67685648
Sequence CCGGAGTTTGTGTGTTGGAAACT CCCGTTACGTAGGACCTAATGGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 69, 3: 303, 4: 788} {0: 1, 1: 0, 2: 0, 3: 0, 4: 11}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!