ID: 974990763_974990767

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 974990763 974990767
Species Human (GRCh38) Human (GRCh38)
Location 4:69085753-69085775 4:69085790-69085812
Sequence CCTGGTTGGTGGTATGTGTCCAA CTTTAGATTTTTTAATTTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 117} {0: 1, 1: 2, 2: 30, 3: 183, 4: 1287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!