ID: 975013318_975013332

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 975013318 975013332
Species Human (GRCh38) Human (GRCh38)
Location 4:69380906-69380928 4:69380958-69380980
Sequence CCCAACAGCGGTTGGTGTGTCCT CTGGGCTTTCTGGGTTAAGTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 131, 3: 107, 4: 133} {0: 1, 1: 0, 2: 35, 3: 219, 4: 556}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!