ID: 975040955_975040964

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 975040955 975040964
Species Human (GRCh38) Human (GRCh38)
Location 4:69743855-69743877 4:69743906-69743928
Sequence CCTGTGGGAACAAGGTGGGGGCC CCTGGGTCAACAGCTGCGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 149} {0: 1, 1: 0, 2: 4, 3: 74, 4: 457}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!