ID: 975058325_975058329

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 975058325 975058329
Species Human (GRCh38) Human (GRCh38)
Location 4:69963819-69963841 4:69963868-69963890
Sequence CCAGACACTGTCTAGGGACCAGG GTCCTGATATTACTCCCTCATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 154} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!