ID: 975080840_975080841

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 975080840 975080841
Species Human (GRCh38) Human (GRCh38)
Location 4:70278592-70278614 4:70278629-70278651
Sequence CCAAATAAAGCTATTTTTAAAAA TTAAGCAATTAGAATAATCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 29, 4: 299}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!