ID: 975112176_975112178

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 975112176 975112178
Species Human (GRCh38) Human (GRCh38)
Location 4:70640468-70640490 4:70640494-70640516
Sequence CCCAGAGAATTCAACGTAGTTGT TTGCAACTGCATAAAGTGCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 12, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!