ID: 975126963_975126966

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 975126963 975126966
Species Human (GRCh38) Human (GRCh38)
Location 4:70793830-70793852 4:70793866-70793888
Sequence CCGGCTCTTCAAACAGGACTTTG CAGTCTGCAGCTGGAAGTCGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 13, 4: 179} {0: 1, 1: 0, 2: 1, 3: 13, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!