ID: 975140877_975140879

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 975140877 975140879
Species Human (GRCh38) Human (GRCh38)
Location 4:70917081-70917103 4:70917106-70917128
Sequence CCTTGGAAAAAGGACCTAACAAA ATGCCCTTTTAGAACAGTGAAGG
Strand - +
Off-target summary {0: 39, 1: 40, 2: 27, 3: 29, 4: 254} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!