ID: 975144345_975144355

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 975144345 975144355
Species Human (GRCh38) Human (GRCh38)
Location 4:70951251-70951273 4:70951292-70951314
Sequence CCCGCCAACCCCTGTGGAAAAGT TCCCTAGTGCCAAAAAGGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 194} {0: 70, 1: 1076, 2: 1645, 3: 1342, 4: 956}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!