ID: 975185380_975185384

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 975185380 975185384
Species Human (GRCh38) Human (GRCh38)
Location 4:71396225-71396247 4:71396265-71396287
Sequence CCAACCAGGTAAAAGATTTAAGA CTTGATGAAATGCAGCAGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 191} {0: 1, 1: 0, 2: 3, 3: 14, 4: 246}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!