ID: 975192014_975192018

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 975192014 975192018
Species Human (GRCh38) Human (GRCh38)
Location 4:71475503-71475525 4:71475541-71475563
Sequence CCAGTTTTTCCCAGGCTGTGTAA TAACTAGGAAGTTGTCCAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 245} {0: 1, 1: 0, 2: 0, 3: 14, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!