ID: 975241950_975241955

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 975241950 975241955
Species Human (GRCh38) Human (GRCh38)
Location 4:72070370-72070392 4:72070407-72070429
Sequence CCATAAGCAAATTCAGGGAGGTA TTTTAAAGGAAAAATGAGGAGGG
Strand - +
Off-target summary No data {0: 3, 1: 11, 2: 27, 3: 144, 4: 1058}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!