ID: 975243882_975243887

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 975243882 975243887
Species Human (GRCh38) Human (GRCh38)
Location 4:72095182-72095204 4:72095235-72095257
Sequence CCAATCCTCAGAAATAAACACTG GTCTGCTGGTGTGCTGGAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 350} {0: 1, 1: 0, 2: 2, 3: 9, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!