ID: 975270381_975270391

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 975270381 975270391
Species Human (GRCh38) Human (GRCh38)
Location 4:72425475-72425497 4:72425488-72425510
Sequence CCCTCCCCCTTCCCCTTACCCCA CCTTACCCCACAACAGGTCCCGG
Strand - +
Off-target summary {0: 2, 1: 65, 2: 1066, 3: 11025, 4: 11384} {0: 2, 1: 15, 2: 375, 3: 3326, 4: 4537}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!