|
Left Crispr |
Right Crispr |
| Crispr ID |
975270381 |
975270391 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:72425475-72425497
|
4:72425488-72425510
|
| Sequence |
CCCTCCCCCTTCCCCTTACCCCA |
CCTTACCCCACAACAGGTCCCGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 2, 1: 15, 2: 375, 3: 3326, 4: 4537} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|